ID: 950792058_950792061

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 950792058 950792061
Species Human (GRCh38) Human (GRCh38)
Location 3:15479847-15479869 3:15479880-15479902
Sequence CCATGGTCAATTTGTGGGTACTA AATTTTTGCCTTTCTTCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62} {0: 1, 1: 0, 2: 1, 3: 23, 4: 383}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!