|
Left Crispr |
Right Crispr |
| Crispr ID |
950795877 |
950795884 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:15510534-15510556
|
3:15510583-15510605
|
| Sequence |
CCTGTCTCTACAAAAAATACAAA |
CTGTAATCCCAGCTACTGGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4906, 1: 182049, 2: 224254, 3: 133293, 4: 96629} |
{0: 20, 1: 489, 2: 3753, 3: 7843, 4: 10766} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|