|
Left Crispr |
Right Crispr |
| Crispr ID |
950796853 |
950796859 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:15517115-15517137
|
3:15517168-15517190
|
| Sequence |
CCTGGGCAACAGAGCGAGACCCT |
GAGGAGAGTTTCCAGAGGATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 867, 1: 15707, 2: 67384, 3: 165843, 4: 236732} |
{0: 1, 1: 0, 2: 1, 3: 43, 4: 419} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|