ID: 950798465_950798472

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 950798465 950798472
Species Human (GRCh38) Human (GRCh38)
Location 3:15530510-15530532 3:15530539-15530561
Sequence CCACCCTCCCCTGTCTTCTTCTG TGTTGTTGCTTCTCCTTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 169, 4: 2274} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!