ID: 950802018_950802023

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 950802018 950802023
Species Human (GRCh38) Human (GRCh38)
Location 3:15560253-15560275 3:15560278-15560300
Sequence CCCAGCTAATTCTGTATTTTCAG GAGATGGGGTTTCTCCATGTTGG
Strand - +
Off-target summary {0: 6, 1: 419, 2: 9249, 3: 22590, 4: 14401} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!