ID: 950867065_950867069

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 950867065 950867069
Species Human (GRCh38) Human (GRCh38)
Location 3:16197544-16197566 3:16197590-16197612
Sequence CCTACTCTACCTGTGAGGAAAAC GTTGCCCTGAGCCACCTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 195} {0: 1, 1: 0, 2: 0, 3: 16, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!