ID: 950874923_950874927

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 950874923 950874927
Species Human (GRCh38) Human (GRCh38)
Location 3:16263176-16263198 3:16263206-16263228
Sequence CCTGCTCTGCTCTGGTCACACTG TTTTGTTCCTTGATAAAATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 436} {0: 1, 1: 0, 2: 0, 3: 50, 4: 511}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!