ID: 950887449_950887455

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 950887449 950887455
Species Human (GRCh38) Human (GRCh38)
Location 3:16374112-16374134 3:16374140-16374162
Sequence CCTTTCACCTTCACCATCTCATG CTCCCAAACTTGATGAGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 38, 4: 386} {0: 1, 1: 0, 2: 1, 3: 7, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!