ID: 950896303_950896313

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 950896303 950896313
Species Human (GRCh38) Human (GRCh38)
Location 3:16454735-16454757 3:16454785-16454807
Sequence CCAAGGCCTCCCTCCTTGTGTCA GTTTTCTGGCGTGTCTCCCAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 35, 4: 323} {0: 1, 1: 0, 2: 1, 3: 3, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!