ID: 950912340_950912342

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 950912340 950912342
Species Human (GRCh38) Human (GRCh38)
Location 3:16607079-16607101 3:16607118-16607140
Sequence CCCTTTAATGAAAAGCTCACAAT CTACTTACCTTGAATAAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 355} {0: 1, 1: 4, 2: 1, 3: 13, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!