ID: 950987410_950987415

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 950987410 950987415
Species Human (GRCh38) Human (GRCh38)
Location 3:17389700-17389722 3:17389751-17389773
Sequence CCCTGCTCAAGTTGTAGATTCAA TTGGGGTGATTTCAATGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 133} {0: 1, 1: 0, 2: 1, 3: 13, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!