ID: 951011187_951011190

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 951011187 951011190
Species Human (GRCh38) Human (GRCh38)
Location 3:17681968-17681990 3:17681991-17682013
Sequence CCTGCACCTTATGAGAATCTAAC TAATGCTTGATGATCTGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 13, 2: 58, 3: 83, 4: 149} {0: 50, 1: 901, 2: 1057, 3: 655, 4: 407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!