ID: 951026612_951026620

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 951026612 951026620
Species Human (GRCh38) Human (GRCh38)
Location 3:17837821-17837843 3:17837873-17837895
Sequence CCTGTGAGAGGCAAATACTTTTA ATGTGGGTAAAGAGGGCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 251} {0: 1, 1: 0, 2: 1, 3: 27, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!