ID: 951030676_951030679

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 951030676 951030679
Species Human (GRCh38) Human (GRCh38)
Location 3:17878071-17878093 3:17878084-17878106
Sequence CCACCTCATTTTCCAATTCTTTC CAATTCTTTCAGACTTTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 47, 4: 699} {0: 6, 1: 0, 2: 3, 3: 18, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!