ID: 951035787_951035795

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 951035787 951035795
Species Human (GRCh38) Human (GRCh38)
Location 3:17930563-17930585 3:17930601-17930623
Sequence CCTGAACTGAAGGATGTTCTGTG CTGGCTGCTGACTGTTGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 160} {0: 1, 1: 0, 2: 1, 3: 31, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!