ID: 951059502_951059508

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 951059502 951059508
Species Human (GRCh38) Human (GRCh38)
Location 3:18188671-18188693 3:18188716-18188738
Sequence CCTTTATTCTTTCAGGGATAGCA CACCATTCTGAGATGCCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 197} {0: 1, 1: 0, 2: 1, 3: 16, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!