ID: 951059547_951059551

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 951059547 951059551
Species Human (GRCh38) Human (GRCh38)
Location 3:18189096-18189118 3:18189109-18189131
Sequence CCTCCCACCTTTTAAAGCTTAGA AAAGCTTAGAGATCTAGAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 151} {0: 1, 1: 0, 2: 0, 3: 9, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!