ID: 951068678_951068682

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 951068678 951068682
Species Human (GRCh38) Human (GRCh38)
Location 3:18299117-18299139 3:18299151-18299173
Sequence CCAAACATACTGAGAAGAACTAA CTCAAGCTATTCCAAAAAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 83, 4: 734} {0: 1, 1: 8, 2: 32, 3: 113, 4: 418}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!