ID: 951069607_951069609

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 951069607 951069609
Species Human (GRCh38) Human (GRCh38)
Location 3:18311662-18311684 3:18311704-18311726
Sequence CCACTGAACTGGAAAAGAACACT GTACTCTGTCCTGTCTGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 271} {0: 1, 1: 0, 2: 2, 3: 22, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!