ID: 951095446_951095448

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 951095446 951095448
Species Human (GRCh38) Human (GRCh38)
Location 3:18624497-18624519 3:18624518-18624540
Sequence CCTATGTCAAAGATTGGTAGTAT ATATTGATAATGGAAAACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 124} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!