ID: 951140002_951140015

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 951140002 951140015
Species Human (GRCh38) Human (GRCh38)
Location 3:19148094-19148116 3:19148130-19148152
Sequence CCCGACCTGTCTCCTCCCTTTCT CACGGGACTCCAGTCTCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 68, 4: 810} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!