ID: 951140218_951140224

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 951140218 951140224
Species Human (GRCh38) Human (GRCh38)
Location 3:19149048-19149070 3:19149073-19149095
Sequence CCGACGCCCGTATTCACTGTGGG CTGCATTTTGGTGTATCTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 34} {0: 1, 1: 0, 2: 1, 3: 20, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!