ID: 951146596_951146607

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 951146596 951146607
Species Human (GRCh38) Human (GRCh38)
Location 3:19234504-19234526 3:19234555-19234577
Sequence CCAGGCGGGTGGGGCTGGCCGGC CGCCCACGCGGAACTCCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 66, 4: 536} {0: 1, 1: 13, 2: 644, 3: 670, 4: 584}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!