ID: 951179448_951179457

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 951179448 951179457
Species Human (GRCh38) Human (GRCh38)
Location 3:19641897-19641919 3:19641933-19641955
Sequence CCCCTCCAGGATTAGAGAGAAAG AAGAACAAAGAGAAGAGGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 19, 3: 143, 4: 1388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!