ID: 951217726_951217739

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 951217726 951217739
Species Human (GRCh38) Human (GRCh38)
Location 3:20040497-20040519 3:20040524-20040546
Sequence CCGGGCCGGGCGGCTGCGGGGCA CCGGGGCAGGGGCCGGGCCCGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 7, 3: 125, 4: 1210} {0: 1, 1: 3, 2: 114, 3: 379, 4: 2074}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!