ID: 951217726_951217740

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 951217726 951217740
Species Human (GRCh38) Human (GRCh38)
Location 3:20040497-20040519 3:20040525-20040547
Sequence CCGGGCCGGGCGGCTGCGGGGCA CGGGGCAGGGGCCGGGCCCGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 7, 3: 125, 4: 1210} {0: 1, 1: 2, 2: 115, 3: 345, 4: 1738}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!