ID: 951221164_951221171

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 951221164 951221171
Species Human (GRCh38) Human (GRCh38)
Location 3:20070150-20070172 3:20070193-20070215
Sequence CCTTCTCCATCCTCATTAATACA TTAGGTATTCCAGATTCACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 320} {0: 1, 1: 0, 2: 1, 3: 10, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!