ID: 951279667_951279680

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 951279667 951279680
Species Human (GRCh38) Human (GRCh38)
Location 3:20732346-20732368 3:20732397-20732419
Sequence CCCACAATCTCTGCACTCTCCCT TGTGACCTCTACTGGGGGGATGG
Strand - +
Off-target summary {0: 2, 1: 19, 2: 54, 3: 148, 4: 507} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!