|
Left Crispr |
Right Crispr |
| Crispr ID |
951352488 |
951352491 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:21623449-21623471
|
3:21623488-21623510
|
| Sequence |
CCTGGACAACATAGCAAGACCAG |
AAGAAATTATCCAGGCATGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 44, 2: 1005, 3: 9325, 4: 32616} |
{0: 1, 1: 45, 2: 1520, 3: 22533, 4: 85799} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|