|
Left Crispr |
Right Crispr |
| Crispr ID |
951352492 |
951352494 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:21623498-21623520
|
3:21623519-21623541
|
| Sequence |
CCAGGCATGATGGTGCATGCTTG |
TGTAGTCTTAGCTAGTCAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 15, 1: 553, 2: 6277, 3: 19577, 4: 53278} |
{0: 2, 1: 249, 2: 6312, 3: 64494, 4: 189815} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|