ID: 951356821_951356825

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 951356821 951356825
Species Human (GRCh38) Human (GRCh38)
Location 3:21677337-21677359 3:21677358-21677380
Sequence CCCTCTTGTGAATTGCAGCCTAA AAATATACAAATCTGGAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 170} {0: 1, 1: 0, 2: 3, 3: 35, 4: 460}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!