ID: 951384573_951384575

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 951384573 951384575
Species Human (GRCh38) Human (GRCh38)
Location 3:22027873-22027895 3:22027899-22027921
Sequence CCTGGTTCACAGATGGTTCTGCA TATGCAGGCACTACCAAAAGTGG
Strand - +
Off-target summary {0: 145, 1: 202, 2: 166, 3: 154, 4: 279} {0: 1, 1: 2, 2: 3, 3: 14, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!