ID: 951519747_951519754

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 951519747 951519754
Species Human (GRCh38) Human (GRCh38)
Location 3:23600242-23600264 3:23600287-23600309
Sequence CCCTTCCTTACACCTTCCCATTA TTGTGATCATATGTACAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 28, 4: 445} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!