ID: 951545589_951545599

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 951545589 951545599
Species Human (GRCh38) Human (GRCh38)
Location 3:23821755-23821777 3:23821781-23821803
Sequence CCGTAGGGCGCGTGTGTGGTGGG CAGGGGAGATGAGGGCAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 93} {0: 2, 1: 2, 2: 14, 3: 168, 4: 1397}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!