ID: 951553621_951553629

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 951553621 951553629
Species Human (GRCh38) Human (GRCh38)
Location 3:23899024-23899046 3:23899065-23899087
Sequence CCCATCTCCATCTGTGGAAAAAT TCCCTGGTGCCAAAAAGACTGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 29, 3: 153, 4: 555} {0: 18, 1: 216, 2: 1415, 3: 1788, 4: 1392}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!