ID: 951577819_951577824

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 951577819 951577824
Species Human (GRCh38) Human (GRCh38)
Location 3:24131662-24131684 3:24131689-24131711
Sequence CCTTGTAAAAGACATCCCAAAGA CCTTGTCCTGTCCATCATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 118, 4: 578} {0: 1, 1: 0, 2: 0, 3: 9, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!