ID: 951604016_951604028

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 951604016 951604028
Species Human (GRCh38) Human (GRCh38)
Location 3:24411689-24411711 3:24411727-24411749
Sequence CCTGGGAACATTTTTTGGTTGTC ATGGGGATGGAGAAAGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 18, 4: 203} {0: 1, 1: 0, 2: 8, 3: 214, 4: 1559}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!