ID: 951604836_951604848

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 951604836 951604848
Species Human (GRCh38) Human (GRCh38)
Location 3:24421595-24421617 3:24421639-24421661
Sequence CCACAGGACGTGCCACCCAGGAC AGAGAGAAAAGCATGCAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 169} {0: 1, 1: 3, 2: 10, 3: 147, 4: 1234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!