ID: 951609458_951609466

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 951609458 951609466
Species Human (GRCh38) Human (GRCh38)
Location 3:24475993-24476015 3:24476038-24476060
Sequence CCTGAGGGCACAGTTGGGAAGCT CCAGCTGCTGCTCTTTGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 177} {0: 1, 1: 0, 2: 5, 3: 38, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!