ID: 951614439_951614443

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 951614439 951614443
Species Human (GRCh38) Human (GRCh38)
Location 3:24525517-24525539 3:24525536-24525558
Sequence CCTGGGGTATACAACCTAACTGT CTGTATGACAAGGAAGAGAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!