ID: 951645232_951645240

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 951645232 951645240
Species Human (GRCh38) Human (GRCh38)
Location 3:24882796-24882818 3:24882840-24882862
Sequence CCTATAGACATGTGCTTAACCAG AACCCATGATTGGTTGATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89} {0: 1, 1: 0, 2: 1, 3: 10, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!