ID: 951671037_951671042

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 951671037 951671042
Species Human (GRCh38) Human (GRCh38)
Location 3:25182347-25182369 3:25182385-25182407
Sequence CCATGGGGTACTGGGCATGGTGC GCAGAAGACCCAGGGAAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 187} {0: 1, 1: 0, 2: 7, 3: 102, 4: 837}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!