ID: 951695164_951695174

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 951695164 951695174
Species Human (GRCh38) Human (GRCh38)
Location 3:25438744-25438766 3:25438793-25438815
Sequence CCTGAAAAATGTTTCATGCCCTA AGTGTTTTGGTTAAGGGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 224} {0: 1, 1: 1, 2: 1, 3: 29, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!