ID: 951710943_951710945

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 951710943 951710945
Species Human (GRCh38) Human (GRCh38)
Location 3:25584482-25584504 3:25584495-25584517
Sequence CCAGAAAGAGCCAGGCCCAAGAA GGCCCAAGAAAAGACACTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 211} {0: 1, 1: 0, 2: 2, 3: 18, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!