ID: 951713462_951713466

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 951713462 951713466
Species Human (GRCh38) Human (GRCh38)
Location 3:25611050-25611072 3:25611086-25611108
Sequence CCAGTTTCAGACATGCTGAGTTT CATTCAAGTGGCTATGAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 30, 4: 249} {0: 1, 1: 0, 2: 0, 3: 14, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!