ID: 951754984_951754989

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 951754984 951754989
Species Human (GRCh38) Human (GRCh38)
Location 3:26081063-26081085 3:26081082-26081104
Sequence CCTCTAAGGGGGTTACAATGTGG GTGGCTGACATGGGCATGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!