ID: 951793713_951793724

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 951793713 951793724
Species Human (GRCh38) Human (GRCh38)
Location 3:26515481-26515503 3:26515507-26515529
Sequence CCCTCTCCCGTCTCCCTCTGTTG AGGCTGGACTGTACTGCTGGTGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 12, 3: 82, 4: 761} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!