ID: 951810431_951810439

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 951810431 951810439
Species Human (GRCh38) Human (GRCh38)
Location 3:26693000-26693022 3:26693038-26693060
Sequence CCAGGGCTTGTTCACATGATGGC GATCAAGAGCAGGCCGGGCGCGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 12, 3: 55, 4: 264} {0: 1, 1: 0, 2: 11, 3: 145, 4: 940}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!