ID: 951888967_951888974

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 951888967 951888974
Species Human (GRCh38) Human (GRCh38)
Location 3:27551537-27551559 3:27551578-27551600
Sequence CCTGGCTGTGGGTATTCCTTGGC GCACTTGTAGCAAGCTCCTGGGG
Strand - +
Off-target summary No data {0: 337, 1: 259, 2: 196, 3: 91, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!