ID: 952037575_952037584

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 952037575 952037584
Species Human (GRCh38) Human (GRCh38)
Location 3:29221197-29221219 3:29221220-29221242
Sequence CCCTCCATGCCCAGAACCTCAAG GCTCCTGGAAGCTGGCACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 223} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!